EST 1833705 is a singleton


Sequence

>1833705 (1 EST) Length=562 TGGGTTGGAAGTAGATGGGTAAAGACTTTTGTGCGGGTGAGTCTTCGGGACCCGCGAAGAGTCCGTCGTTGATTGCCGTT TCACCGCTGCACGATGCTCTTGTCGTTGTAGACATGCAAAATGACTTTGTAAGTCCATGCGGGGCACTGTCGGTCCCTGG GGCGATGGAGGTGATCCCTGTAATCAACCACGTCTGCCAGGCGCACAAATTCCGCACCATTGCTGTGGCAAAGGATTGGC ACCCACCGGATCACTCCTCGTTCTGCAAACCTGCAGGACCCGGTGGACAGTGGCCGCCCCACTGTGTCCAGGAGACAGAC GGTGCCAAGCTGCATTCTTCACTGCGGCTTGGCAGTGGACTGTGTGATACACAAGGGAGCAGACAGGGACGCGGAGTGCT ATTCCTGCTTTAGCGACGTAAACGGCAAGAAAACCGGCCTCGCCACGTTTCTGCGGGAAATGGATGTACGCCGTGTCTTC ATCTGTGGTGTGGCCTTCGACTTCTGCGTCTATTACACAGCACTGGACGCCGTGAAGGAGATGTTTGATGTCGTTGTGCT CG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1833705: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18337053415219AI078947TENU3665T. cruzi epimastigote normalized cDNA Library


Date: 20:56:4 on Thu 23 Nov 117.