EST 1833710 is a singleton


Sequence

>1833710 (1 EST) Length=481 CATCAAGTTACTGCGCGACTGATCATCTGTCACCATTTCTCATCCTTCTCTCTGTTCGGGCGATGAAAATAAACCGGCCA GACAATTACAGAGATGCCGAAACGAAGGCGCTTCTTGGTTTTGCGGCAACCCTCGAGTGCCTTGCAGATTCGTGGTTCTG GGCCCTGTTGCCCCTTCACATGATAGAAGACTTAAATAGTAGGTCTCTTGCGGTGAAAAATTTTCTTTGCCGAAACGTGT ATCGATACAAGAAGGGCAGCTACGGGAGTAATGCCGATTTCAAGCGTCTTGTGGAGCTTTTCAAGTTAGACATGTCGTTA CTCAATCCAAAAGAGCCACCCGTAGAAGTTTCATTCGAGAAACCGATGAATGCCCCCAGCATTCGCACCCACACATCTCT CTGCGAGGCGCTTGAGAGATTTGGCCGGAACTTCTCCAAGGAATAGAATTGTTTGTAAATAGGACCAACCCCAACTAAAA G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1833710: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18337103415224AI078952TENU3670T. cruzi epimastigote normalized cDNA Library


Date: 0:55:29 on Wed 22 Nov 117.