EST 1833719 is a singleton


Sequence

>1833719 (1 EST) Length=303 CACCACCATCGGCAGCAACGGCATCGTTGGGCACAGTTGATGTTTATACGTGAACCCTCATCACGCAACGTTGTTTTACA GCAGTTGCAGTGGAACGCCGTCTGTTTGGATGATATCGTCTTTTTCCCTCTTTTTATGTCTTCAATTGCCGCGGGTGCAT TTTCGGTCACAATCTTCAGTTTTCGCGCTGACGTCATTCCGCCACTCGCCGTTTGTTTGTTTTGCCGGTGTGCGTGCGAC AGTGGGAGTGTGTTCTGTTCTCTCTTCCCTAGTTGCCGTGCGGTCTTGTTGCCCTTCTTCTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1833719: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18337193415233AI078961TENU3679T. cruzi epimastigote normalized cDNA Library


Date: 22:43:15 on Thu 23 Nov 117.