EST 1833725 is a singleton


Sequence

>1833725 (1 EST) Length=378 CTATAAGGTAACAGAAAAAAAAGCCAATGTCTGTTAAGGACGTTAACAAGAGGAGCGGTGACTGGAGGGCAAGCTGAAGG GCAAGCTTTTTTTGGGCGGCACAAAGCCTTCCCAAGATGACGTGAAGCTGTTCAACGAATTGCTGGGCGCCGAAAACACA TCTTTGTACCGTTGGGTGAAGCATATGGCATCCTTCACGGAGGCGGACGGCAAGGCGTGGGGGGCCCCTGTGAAGGTGAC AGCTACCACTTCGGCTTCCGCTCCCGCAAAGCAGACACCAAAGAAGGCGGCGTCTGCCCCGCCAAGCAGGCCGATGAAGA CGAAGACATTGACCTCTTCGGGGAAGCGACGGAGGAGGAGACGGCTGCTCTTGAGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1833725: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18337253415239AI078892TENU3685T. cruzi epimastigote normalized cDNA Library


Date: 23:20:29 on Mon 20 Nov 117.