EST 1833731 is a singleton


Sequence

>1833731 (1 EST) Length=482 TGGGCTCCGTGGATTACCGACTAAGTAACAAGAAAGAGAGTGCGCCCATACCAGTACTCATTGAGGCCTTCACGCAAACG CCTCAGTTAATGACGCGCAATGACGTTGTTCGCGCCGCGCATCGCTATGGCTCCGTTGCCGAGCTTCTCACTGCTTCACT TGAGGATTTGACCTCCCTTCCAGGGTTTGGACCAAAAAGAGCCGGAACGTTCACAATGTTCTTCACGCGGGATTTCATGC TTCTCGCCGTCTGTTGTCGGATTTATTGACAGAAAGTAATGAGCTCCGCGGCGTGGATGAGATGCGTTCTGCACCCGATA GAGTTTCGGCGCGGGAAAAGATGTTGCAGGTGTTAAATCAACTACGATGCCGCGAAATGGAGGAGGAATCGCCAACGGAT TGACGCGAGAAGAGGGAGAGAGGGGGCAGAGGGTTTGCGGAATTGCGTGCGTGTGTTTGTTTGTCCGTGTCATTATTCTT TT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1833731: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18337313415245AI078898TENU3691T. cruzi epimastigote normalized cDNA Library


Date: 10:9:56 on Wed 22 Nov 117.