EST 1838641 is a singleton


Sequence

>1838641 (1 EST) Length=485 TGGACGCATCCAAACGGAAGAGGCAACGCTCCTCTGACAACTCCCATTCTCATCGTCACGGACGCCGTAGGAACGGCCCT CGCGATCAGGAAGAATGAAGGCATGTGTTTTGTTTTTTCTGTGTTTCAAGCTCCCGTGTTTGTGTGTGTGTGTGTGTGTG TGTGTGTGTAAATGTGAGAGGGATGGAGAGTTATAAACACACGCGTCCACAATTCCTGGCGCCGTTGGATATTAGACGCA TACACACGAATAATGCAAGAAAAGAGGAATAAACTAAGGAAAAAAAAAAAAAGAAGAAAAGGGAGGGCTGGCAAACTCTC CATTTGTATTGCTTTTTGACGTTCTGTGCTTTATTTGTTTTCGTGCTTGGGAGTAGAAGTGACTCTCTTCCTCTCGACCC AATTGCTGACCGAACGGTTTGCCTGTTCGCGGATTCTCGTGCTCTCTTATTTGGGGAGCTGTTGGGGCGATGAAGCGTAT GGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1838641: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386413417053AI080801TENU3509T. cruzi epimastigote normalized cDNA Library


Date: 13:28:19 on Fri 24 Nov 117.