EST 1838650 is a singleton


Sequence

>1838650 (1 EST) Length=465 CGTAGCTTCCACTTGAATCAGACCGTGGCGTTTCCATCCAAGTATAATTCCTCCCTTATTAAGGAGATGTTTCCCGAGTT GTAAATTGTGTCCAAATTGCTCCTTTGCTGCTTTATTTTCTCCAACAGTACCGCCACGTGCTATTTTTCGGCCATACCGA GAGGTATTTTTGACATCCTGAACGGGTTTGTAGGGTTAGGGATGTTTCTCCAGCGGGCCAACATGTTCCAGTTTTGGAGA CGCTTGTGAACTATACGGGTGGTTTTTCAGACCTCAGAGTCACTCTGTTACATTCCATTTACTTCCGCCTAACCGAGGCG AATGTGACGCTTAAGGTGCTGAAGACGAATGTTGGTCCGATCGATGAGAAAGCGTTGAATGAAAAAATCCGTTTTCTTTT GAAGTGGGTCTTTCTACCTATGTTTAACGTCAATTTTAAGGGGATCCCTTTACCCTCACAAATCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1838650: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386503417062AI080810TENU3519T. cruzi epimastigote normalized cDNA Library


Date: 8:21:52 on Fri 24 Nov 117.