EST 1838653 is a singleton


Sequence

>1838653 (1 EST) Length=455 CAAGAAGAAGAAGAGCAAACTCAACGCCACGCACTCGGAGCATGCAAAGCGAGGCAAATTGTTTAACATGACGAAACGTT CACGGCGCGTGGGAGCGAAAATGAAGGAGTCTGCCAGTGACCGGTCAAATCGCGGCAAGGAGAACAAAAAGAAGGACATT AAATTCCGCATTCGTCGCGGGTGGAAGGCTTGACCTCATTGTCGTGCAATCCACTTGTCTTTTTTTCTTTTTTGCACTTC TGTCTGTGTGTGTCTGCATGGCCCTGGGGCTCGGAGTCAAGGGAGGGACACGGAGGAAATGTGCGATTCACACCCGCATA CATGCATGCAATACACGCAAGAGGCGCCTGGGAGGAATGGAACAAGTGTGGACTTTAGGCAGCAGAAGCACACCGCTGAA AGGCAAAATGCAGTAAAATAAAGAGAATCCACGGTGGCATAGGGGCTTATAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1838653: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386533417065AI080813TENU3522T. cruzi epimastigote normalized cDNA Library


Date: 11:42:2 on Wed 22 Nov 117.