EST 1838654 is a singleton


Sequence

>1838654 (1 EST) Length=569 TGAATGAGAATAAAACATTGAAGCAATTAAATAAAGAACCTTTTTTCCTAACTTGTTTGGTTTCCATAGATAATTTCAGG ATCCGGCCAGCTGCCCGGAAGATTATTCTATTTTATTTTTACCTATGAAAGCTTTTTGTTTTTATTAATGCCGCGTTGAA AAGGCGGTGAATGCATTGCCTTTTTCCTGTCTTTTCAAATTATAATAAAAAAGGCTTTTTGTTCTTTTTAACACGAGCAA TTGACTGATTCCACTGGGGTTTCGGTGTTGGACACACCGAGACAAACTGTGATAACCTCGTGCCTCACTTTTGCCTTGTG AGAATACGGAGACAGGGCCGGAATGAGGCGCATGACTTTTTTATTTTTGTTTCTTGTCCGATGAAAAACGCTTTCTTTGT GTGTGGACGTACTTTGTGAAACGTGGAATTAATGGAAACTGTGGAGAAGGAAAGAGGTAAGAAATTATTGATGGGAAGGA TTTGTTGTTTGTAATTAAATGCCGTTAAGAATTCGTGGACCACTTGTCTTTAAATCATTTGTATTGGTTGATGATTTGCC GATGACCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1838654: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386543417066AI080814TENU3523T. cruzi epimastigote normalized cDNA Library


Date: 21:3:35 on Sun 19 Nov 117.