EST 1838655 is a singleton


Sequence

>1838655 (1 EST) Length=595 AGAGTGGGATCACCCCTGCAAGCTACGAGTTTTCTCCGCAATCTTTCTCCACGGGAGCTGCTGCAGCCACCACCTTGCGA CATGTCGTTTTTGCGCCGCCGCCGCTATGGCGCCATGGCTTCTGATCTGGAAGAGCCCCCGGTGTCTCCTTTTTATTATG AGAAGTACAGTTTGCTCTCCGATCCATTGCAGCACCCTAGTGGTCCTTTATTTCGACGGGGTCGTTCGTCCCGCGGCTTT AGGCGCCCGTCTCAGGAGGACGAAAGAAATCTTTTAGGATGTTGGGGGCATAGTGATGAGAGGTCTGACGGTAACAGAGC GGACGAAAATGAGTTTACTTCGTTGCCGCCGTGCGAGAAATTTCTACTGCATTCACCAGTATCATTACGTCGTCTTTCCA GCAGTGAATCTCCAGAGTCGCAGTATGCGATGCGACGACGTGAAACAGACCGTGCAGAAATTCTTTATGAGTACAACTGG CTGCTACAGCGCGAGGCGTACGGAAAGAGCAGCTGCGAAAAGAGCTCGAGCTTCTCCGATACGAAAGGGAGGTTCGTGAA AGAATGATGTGCCGTGGCCCCACCGCACAGATGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1838655: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386553417067AI080815TENU3524T. cruzi epimastigote normalized cDNA Library


Date: 16:28:28 on Mon 20 Nov 117.