EST 1838659 is a singleton


Sequence

>1838659 (1 EST) Length=417 AGAAGCCATTTTTGTACTTTGCCTTGATGAAATGGAACCAAAATCCCTTGAAGAGGAGAGCATGATGTACTTGTGCGGCA ACGGCCACAATCGTTGGTGCGACAAGAGCTTCAACGTCATTGTCACGGAGGGCGGCCACTGTGGTGTGCATGCGGAACAC TCATGGGGTGATGCCCTGACCCTCGCAAATGTGGTGGAGTACAGTCACGCTTCGGATAAATTTAGGGAGTTATACACAGA GGATGGGCATGTAAAAAAACTACCCGAAGATGAAGTGGCACTGGCTGATGGTAAATTTAAAGTGTTTGTCCCTAATCGAA TTCGGTTCACCATTGATGCCGTGATGAAACGTGCTGTCCAAGGCGTGCAGGAACGGTGCATTCGCGAAATAAAAGATGTT GACATCCGCGTCTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1838659: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386593417071AI080819TENU3528T. cruzi epimastigote normalized cDNA Library


Date: 4:44:48 on Thu 18 Jan 118.