EST 1838661 is a singleton


Sequence

>1838661 (1 EST) Length=428 GAGTTGGTGACACGTGAGACATGTCCCCCTCTTCTTTTTCTCAGCGTGGATGGTCATCGGTACAATGTTGTCCTCAGCTT GTACATGCGGAAGTACTGCGCAAAAGTATAACTTAAATATGCAACCAATGGTCGTCTTCATTACAACCTCGCGACTCCGT AGTCTTGGCGGGGATCTGCGTCCCATGGAGAATGATGTGCCGCCCTTCACATGTGTCATGAATGACGAGATTGTTTCATT TCATCACAGTGAACACACCACAATATCAGAGAAGTTGTTGCAAAAGGCAACGGCTCTTCGGCGCGAACGATTTGATCGTG CCCCGGCGTCTAATGTATAATGTACGTTAGGCACAGATGGAACGAGGCAGAAACAGAGAGCTGCCAATATTCCAATTCTT CTGCACATCACATATAACTGGGCATTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1838661: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386613417073AI080821TENU3530T. cruzi epimastigote normalized cDNA Library


Date: 16:15:50 on Fri 17 Nov 117.