EST 1838666 is a singleton


Sequence

>1838666 (1 EST) Length=427 TGAAATGTTTCTTTGACGCCGTTCGAAAGGCGGCGATGTGTGTTTCCTCCTACCGGCTTGCCAAGAGCAGTAACCAGCCG TCGGAGAACCTCATGTTTCTTCACAGTTCGCCCTGCCAGGATGATGCCATCGCCGGCTCTGCCGTGGTTTGTGATGAGAT TGACGCTGATGGCAGTTTTAAAGGGTGTCAGGCGGGGAGCTGCGTGCGTGGATGGGTGGGTCCTTTTTTTCTGCACTCTG AGGCGGCGGTGGGCATTCACGTGCTTCGACTCGGTTGACAATCAACACGTGTCATCTTTCGTGTGCCCCGCCGTTGCTTC TGGTGGTTGTTCTCTAAGACTTTCTGGCCCTGACTTCATTGGGGAAAGTCGCACACACACGCACATACAAATACATACGC ATGCGGCTTTATTGGAGAGGGATCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1838666: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386663417078AI080826TENU3535T. cruzi epimastigote normalized cDNA Library


Date: 23:11:8 on Fri 24 Nov 117.