EST 1838674 is a singleton


Sequence

>1838674 (1 EST) Length=298 CTGTGGTTTAAGGGTTATGGTGGTTCACGCTTGAGGCCAAAATGAACGCCAGGGCGTCGTGTAGTGTCACAAGATCACCT GCCGCCACAGAAACAAACAAGTCCTTCTTTCTTTATGAAGGTATTTAAGGGCCACGCTGGCGCGCCCACAATGGCAGGTG CGTATGAGATTGCCTTATGTCATCCCTTTGACACTGTCTCGAAGCGACTCATGAGTAACCGCACTCGCATTCAGAGCGTC TCATTTGCAGATATCTTGCGGAATCTGAACACCACAATATTCAGTTCAAGGGCGGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1838674: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386743417086AI080834TENU3543T. cruzi epimastigote normalized cDNA Library


Date: 20:52:24 on Wed 22 Nov 117.