EST 1838686 is a singleton


Sequence

>1838686 (1 EST) Length=354 CGTCGTCGTGTGTATGTACGTATCAGGTGAGACGGAATGCGTACTACTCGGTGCACCCAGTCAGTCTTTTGGAGTTCACC ATCACGGCGCCACCGACTCCGCTTCCTCCTCGCCTTGAGGCATTTGTTTGCGACCACCTCGGCACCTTTGTCTTGGGCGA CTCCGACACCCCGGCGACCACAAGAAGGACGAAAAGAACGGCGAAGACCCCAAGCACCGCGTCGGAATCGACAGACAGGG CGCAGGCTGCGGCGAAGGCGTCACGAAGCGTCGTTGCAATGCATGGCGACTGCGATTTCCCACGTGTATTTACACATCTG CGAGAGGTTAGCATTCAAACCGATGTGGCGGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1838686: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386863417098AI080846TENU3703T. cruzi epimastigote normalized cDNA Library


Date: 14:18:47 on Mon 20 Nov 117.