EST 1838687 is a singleton


Sequence

>1838687 (1 EST) Length=214 TGGAACCGCCGCCGTCGATTACCGCTTGAAGGAATTTCTCTCGCAGTACATTTCTCAGTACAATCGCCTGCTGGAGGTGA AGAACCGAAAGCAGCGCCGACGCGGTGAGGGGACTTTGGTGGGGGTTCCTGAACTGACGGTTTCACGTTATTGGCACATC AACGCGCGGTACAATCGTTTGCGGTACAACCGAATAGTTGAGACCGTAGAGCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1838687: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386873417099AI080847TENU3704T. cruzi epimastigote normalized cDNA Library


Date: 5:43:31 on Sun 19 Nov 117.