EST 1838692 is a singleton


Sequence

>1838692 (1 EST) Length=407 CGCTGTTGTTGCGGCTCTGAACAATGCATCATCCGCAGAATTTGAGTGTCAAGCATTCAGCTTGATGCGATCACTTTGTG TACTTCCGCAAGATGCCGCAATGTCATGGAAGAAGGCGGATTAGAAGCTGCGATTCGTTCGATGCACGATCGCTCCAACG CTGAGGAGCGTGAAGGTGCGAGAACGATGGCAGTAATGGTCCTATATCAGATCAGCTTTAACACGGCAGGTGTTCGTTGG TTAATGGAGGCCGACGTACCACCTGGATTTGAGTTACTAGACGCTCCTATTGGTTCCTCAACACTTGTAGTGACTAAGGA AGATGTAATTGCAGCCCTTGTTTTTGTTATTGAACATGATGCCGAAACTTTGACTGATATATTGCTTTACGCCGTCACCT CGCTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1838692: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18386923417104AI080852TENU3709T. cruzi epimastigote normalized cDNA Library


Date: 15:4:59 on Fri 24 Nov 117.