EST 1838701 is a singleton


Sequence

>1838701 (1 EST) Length=539 TAAAAAATTCAAAAAACACGGATTGCCAATCCGCTCGGTGTTGTCACTAGAACACAAAAAAGTGCCGTGCACACAGCTCC AGGTGTCCAAACAACACACAAATAAAACAAAAAAGAAATTAAAAGCCCTCAACAACAGCGACTACCGACACCGCAAAGCG ACCGCACACACCAACCAACAACCACACGAAAAGTGGCCAACAACCAAAAACAGCACAGAGAAAATAAAGATAACAACAAA GGAAAAAAGTGCGCCCACAAAAACACACATATATAAATATATAATTGAGACTTACAAAAAATCTAAAAAATATTTCACTT AACAAATAAAATAGTACGCACAAAACAAATACTAATAAAGCACAGGAGAGGTCTGTCTGCGTGGAACCGCGCATCGAGGG TCCTCGTCCCCGCCCTCAGCACAGCAGTCACGAACACCCCCGCACCCATTGGGTCACGGCGACTTCCCATCGCCTGCCCG CATCAGAAGACGCACGTGGGCGCATGCGGTGCTGGGACTCGTCCCCTCCCTCCAGACCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1838701: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387013417113AI080861TENU3719T. cruzi epimastigote normalized cDNA Library


Date: 3:43:41 on Sat 18 Nov 117.