EST 1838703 is a singleton


Sequence

>1838703 (1 EST) Length=419 AAAAAAAGAAAGAAAGAAAGAGAACGGTCCTTAATGAGGAGGACGGAAAGGAGGCGTATGGTGAGCCAACATGGACGACA CCGCCGCGTTGTGTGCGTTGACATGATTAAGTACACCGACGTCTGAGTATTTCGAGTTGTATGGATCTTCCCGGTGTGGA CGACAAGACGGCGTGGCAAGGCACACACAGACACACAGACACACAGACAGACAGAGAGAGAGAGGGAGAAAGCAAACTAA AGGGTTTCTCGAATTTCCCCCCTTCACCTCCTCCCTTTTTTGTTTTTTTTTCACTTTACACGCACGCACGCACGGAGTGA CAACAACAACAAAAAAGAAAAACAACAAACAAACAAACAAGAAAAAAGAAAAACGAAGAAATGTGATGAAAAAAGGAAAT TTCTGAAATGTGGCAGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1838703: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387033417115AI080863TENU3721T. cruzi epimastigote normalized cDNA Library


Date: 23:33:33 on Sat 18 Nov 117.