EST 1838708 is a singleton


Sequence

>1838708 (1 EST) Length=204 GGTCTACCGCACGGACCCCACCGTTGTGAAGGACGAACTCGTGCTGGAAGGCAATGACTTGGAGGAAGTCTCGCGCGAGG CCGCCGTGATGCATCAGCTCTGCCTGGTGAAGAAGAAGGATATCCGCAAGTTCCTGGACGGCATCTACGTGCAGACCAAG ACCAACGTCGTGGCGGAGGAGTAGGATCCCTTTTGGCCAGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1838708: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387083417120AI080868TENU3726T. cruzi epimastigote normalized cDNA Library


Date: 17:58:19 on Mon 20 Nov 117.