EST 1838715 is a singleton


Sequence

>1838715 (1 EST) Length=522 TGAGTTGAGTGAAATAAAAACACGAGGGGAAAAAAGAACAACAAAAGCGAAATCTCTTCCAGTTTTCTTCCGGTGCTTTT GCTGCCTTTTTGAAACGGTGTTTCCCACACAAATTTCAGATTACGTCACGGCATCTTTCAAAACGGTAACTGCCGCACAA TTTTTTAAAGTGTCGTAGTGATTTTGCTGAGTTATTGCTTGAGAGGATGGATTTTTTGATTGGACGCTTTAGCGATGATG GTGACAAAACCGAGAATATTTTGCCATTCCTCAAACGATGTGTCGAGGCATGTGTTGACACGACAAGGACGGCTGAGGTG GGCGGGGGATAAATTATTGCTGACCCTCTGCTCGAACATTTGATTTGTTTTGTTTATGACTCGCTGAATATCGATGAATA CTTCTGCGCCCGTTTGTTTGGAGCGTGTCTCGCAGCATACGGCAGTGAAGTGGAACCCGCCTGTTTTACCACGCAGACGG GGTTGCTCCTGAATCAGGAAGTATGACTGGCGAACGGAGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1838715: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387153417127AI080875TENU3733T. cruzi epimastigote normalized cDNA Library


Date: 0:50:11 on Fri 24 Nov 117.