EST 1838718 is a singleton


Sequence

>1838718 (1 EST) Length=334 CTCTGTTTGTTTGAAAAAAACGTTGCACTCAACGAAAACAAATGAAAAATACAAATAAGAAGGAAGGAAGGAAGAAGAAG AAAAAGAAAAGGAAAAAAAAAAAAAAAACCGATATTATTTAAGCGCCGCCTTATTTTATTTTTATTTTTATTTTATTGTT TGGCTTTTGGGAGGGATGGCGGGTGGAGCGAATTGAAGAATGGAGCCCGCCACCCGCCGGTGTCTTTTTTTTTTTTTTTT TTTTGTTCTTTTGTACTCTTTCTCTCCGTCCTTTTCTTTTCTCTTTTTTATTGCGTTCTGTTCTTTTTTCTTTTTTTGGT TGGTTGGTTGGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1838718: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387183417130AI080878TENU3736T. cruzi epimastigote normalized cDNA Library


Date: 8:32:25 on Fri 24 Nov 117.