EST 1838720 is a singleton


Sequence

>1838720 (1 EST) Length=240 TTATATGTTCATCTCTTAAACAAATAATGACATATTTATTTTTACGTATTTACAGAAATATATAAACAAAATAAAATGTA TGACAGATAGTACTTCTCTTGCCTCCTAAAAATCCTTTTACCTCCCCGCCTCTGGGCGTCAATTGCGCATTAAATACGAG ATATGAAGTAGCGGCTAACACATATGCCGCACAAAACACCCTACACGTGGCTGCTCCCTCGTCGCCCTCCCCTGCCATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1838720: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387203417132AI080880TENU3738T. cruzi epimastigote normalized cDNA Library


Date: 19:16:41 on Sun 19 Nov 117.