EST 1838733 is a singleton


Sequence

>1838733 (1 EST) Length=516 CAAAGGACTGGGAAGGAGGGCGAGGAAAAGGAAGACGAAAAGAAATAATGCAGGTTTAAGGAAGAACTGTCCTCTTGCAT GTGCAGGTGCCGCATTGCCCTTTTTTCTTCTTTTTTTTGTTCTCTGTATTGTGGAGGAATTACCAACACAGGTCAGATGC GTACGTGTAGGAGAGGCAGAGAAAGAGGGTAAGGGAGGCACAAATGCATACGTGCATGTGTGTGCGTGTATACACCATCA ACCTCATCGTAGGAAGATGACGAGGATTTAATTGCGTGGAGAGGGGTGGATGAAAATAACGGTGTGTGAAGTAAAAGGAA GCCGTAGAGAAATAAGGGAAGGGGAAGGAGGGAAAAGAACGGGGTTTACGCTGCATTGACAGGCAGTGCACCTCCGCCGC AACAAAGAATGAAGGAGTCAAAGCGACGAAGAACACGAAAGGTTACCAAAAACGAAATTCATGGATCACACAGACAGACG CTTGGCGGGAATGGGGGCTAGACGACGTGCTTTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1838733: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387333417145AI080893TENU3751T. cruzi epimastigote normalized cDNA Library


Date: 11:18:28 on Sun 19 Nov 117.