EST 1838738 is a singleton


Sequence

>1838738 (1 EST) Length=520 CAAAAGGCGCGGCACGACACTCGGACAACGACACCTTCAGCGGGGAAATTGCGGACTTGCTGTCCATGGGTCTGAACCGT GACAGCACCGTGCATGTGTGTGTATTTCGGGTGTTGTTGCTGCTTCTTCTGCTGGGGCTGTGGGGCATTGTGGCTCTTTG AGGAGTGATTGGCTGCCGCGTGGGACACTTTCGCCCTCCCTTCACCGACACACACACACCGCTGGGAATAAATTTTGCTA CGCAGAGAACAATTTCTTTTCATTTTTTAAATTGTTTTCCTATCTTGCTTGTTGCCTTGGGGCAGCCACCATGGACTTTT TTCTTTTCTACTCTTCCCTCTTTTAATTGTTTCTGCTGCACTCTTCCTGCGAGGGGTGCCGTGTGTTTCCCGCCCAACTG CTCCACTCGCACACCCACCGACACGCTCACGACGACGGCCCTGTGCGCCTCGCCTGCTGCACGCATGAGGAGGGGCTGCG ACGAACGGCGCGCTGGAGGGAGCCGTGACGTGTGGGCGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1838738: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387383417150AI080898TENU3756T. cruzi epimastigote normalized cDNA Library


Date: 6:4:5 on Sun 19 Nov 117.