EST 1838748 is a singleton


Sequence

>1838748 (1 EST) Length=314 CTTTACGTTTGGGTCACGGACAACAACCGCACGTTTTCTGTTGGACCGACGCGAAATTGACACTGCGTGATTTAAGCGGT AACAACACCGTGCGTGTGTGCGTGTCGTGTGTGTTGCTGCTTCTACTGGGACTGTATTTAGGTGACGGCAGTCTTCTGAG CCACGGAGTGTGGATCTGCGACTCCTCACGGAGAATACATGCCGCATTGCCCGTCCTTTTTTTATACCACCGTTTTAATT CTATTTTACTGCTCGTNTAGTTCTTCAATGTCTTTACTTTTCAGTGTTCTTTTTAATGTAGTTCAGCCGGAGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1838748: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387483417160AI080908TENU3766T. cruzi epimastigote normalized cDNA Library


Date: 13:34:5 on Fri 24 Nov 117.