EST 1838753 is a singleton


Sequence

>1838753 (1 EST) Length=453 TCCTCCTTCCTTCTGCCCTCGCAGTGTTTCTGTTTGTGAGCTCTCCTTTCAAGCTGAGTCGCACAGAATGTTTCGCTCTA TGACAATCAATACTTCCCGTGAATTTCCACCCAACATCCTTCTGCCCAATCATCCTTTTCCTGCTCCTGCTGTTGTGTGT GCGTGTGTCTGTCTGTCTGTCTGTCTGCGTGCCTGTTTTTCTGTCACCCTCACGCATGCATGCCGACGAGAAAAGAGGTG GCAGCATTCACTTACCTTCGCCTACGGCGGGGGCGGTGCTCCTCCCGCTGCGACTCAGCTATTTGCTGTGACTTGGACAC TTTATTTTTGGCTCTCCCTCTCCGCGGACCCCCTTTTCCGCCCTTCAGTCCCATTTTTTTTCCCCGTCACAATCGAGGCG CAGAGCGTCCTCGTCGCCGTGTCCCCGCAAAAGTGGATGAGTGCAAAAAAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1838753: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387533417165AI080913TENU3771T. cruzi epimastigote normalized cDNA Library


Date: 7:32:59 on Sat 18 Nov 117.