EST 1838756 is a singleton


Sequence

>1838756 (1 EST) Length=602 TTCAAGTCATACGAGAAAAAGTGAAGGTGTTTGCACAGACGGCAGTGGGTAGCGTCGGGCACAAAGTGAGTCCGATGGCC AGGTGTACCCTGTCCCTCAATTCAAGCTCATTATTCTGGACGAAGCGGACGCGTTGCTACCGGATGCACAGGCCGCCTTG CGCCGGATGATGGAGGACTTCAGCGATGTCACACGTTTTTGTATTCTCTGTAATTATGTCAGCCGTATCATCGATCCCAT AGCCAGCCGCTGCGCCAAGTATCGGTTCAAGCCTCTTGTAAGAGAAACCTTGTACGATCGGATTCGAGAAATTGCAAAGA TGGAGGAAATAACCGTATCGGATGCCTCTTTGGAGGCGCTGGATCGTGTGAGTGGTGGAGACTTGCGGTCTGCCATCATG TATTTGCAGTACGCACAGAAAGCGCATGGGAGTGACCTTACAAAAGAAAACTTTTTGGAGGTGTCGGGTAGCGTACCAAT GGAGCTGTTGGAAAAGTACTTGAAGGCGCTTGTGACGAAAGACTTTGATGGCATGTATTCCTTGACGAAGGAGATTGTTG GGCAGGGATTTCCGGCAAGTCAGCTTCTTTCGCAGCTGCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1838756: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387563417168AI080916TENU3511T. cruzi epimastigote normalized cDNA Library


Date: 0:58:53 on Wed 22 Nov 117.