EST 1841480 is a singleton


Sequence

>1841480 (1 EST) Length=379 TCCCCTTCCTTGCTGTCATGCTGAAGCGCACACCGTGCTGAAGGTAAAAGGTCTCCTCCCTGCCGAGGACCTCGTGCGGA ATTTTCAAATGGCCTTCGAGCACTGGGACGGGCGGTTGGCGGAGGAGGTCCACCAGCGACTGGAGCGAGAGGAGAAGGAG CGCGCCCGCCGCGAGGAGGAGCAACGGGCCCACGAGATGCGTGCAATCGACCTCGAGCGCATCCGACGGTACGAGGAAAA AGTGCGGGAGCGGCGGGAGCGGGAAGAGCGGCTGCAGCGCGACGCGGAGGCGGCGGACGGGCAACGGCGCGAGGAGGAAG AGATGCGGAGGAGGCAGCAGCAGGAGGAGGCGCGGCGTCGCTCTCGGGTGGAGGAATTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1841480: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18414803421523AI083100TENU3777T. cruzi epimastigote normalized cDNA Library


Date: 2:36:34 on Fri 24 Nov 117.