EST 1841486 is a singleton


Sequence

>1841486 (1 EST) Length=473 AAACATTGGTCCAGCGCGATGACCAGCTCAATGCCCATGACGCGAAGGTGGAACAATTGGGACGTAAAACTTTTGTTCTT CAAAATGCTATTGCATCTCGCGCCACCTCCGCCCAGCTTCAGGTCAAAGGGAAGGAAAAAGAATTTGAAACGCTCATGTC CCACGTTGACTACATGAAGGCGGAGTTTGACGAGGAGTACAAGAAGCTCTCCCGGGAAAACGCCATGCTGCAGAGCAAAC TGGCGCAGACGTCGTGAGAATTATGAAACACGCATACAATAATATTAGTTATTCGCTTTTTTTTTTTTTTTTTTGTTTTG GTTTCCTGTTTTATTATTATTATTATTGATACCTCTCACCTTGTTTTGTAATATATATGTGTGTATGTAACGCAGAGAAG AAGGGCGACGCGAATGGTCCTTAGTGAAGGCAAAGGAGTGAAGAAACAACAAGGAGGAAGAGAATCCCCGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1841486: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18414863421529AI083106TENU3783T. cruzi epimastigote normalized cDNA Library


Date: 21:18:26 on Sun 19 Nov 117.