EST 1841492 is a singleton


Sequence

>1841492 (1 EST) Length=393 GATGGCAGCGCTAATGGCTGTTCTTATGGGGATTCTTATTCCAATCGCCGTTGCCACCATTTGCGGCAGTGGTGGCCTCT TTTTAAGCTGCAGTGATGGGTCGCACACATTCCCTGGCAGAGAGAGCCACGACGGTGTGTCCCACGCGGCTTGCATCTGA TACCGCGTTTGTGGGGCAGGCATGGATGGCAAAATACACCAATCGATACCAGTTTCTATGAGAAAAATTGCGGAGGGAAT TTGATTCTGGATGAGGCGCCGTAAACCAGAGAGAGAGAGAGAGAGAGAGAGAAAAAAGAGAGGGAGAGCAGCTTTTTTAC ATGAGTTGGCTTCGCTACTTCTGAATTTGATGTGTGTGTGTGTGTGTGTTGTTGTTTTTTCAATCGTGGGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1841492: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18414923421535AI083112TENU3789T. cruzi epimastigote normalized cDNA Library


Date: 21:59:17 on Fri 17 Nov 117.