EST 1841501 is a singleton


Sequence

>1841501 (1 EST) Length=362 CGAACATTGTGGAATGGGATGAAACCTTATCTGCATGCTTTTTCTCCTGGCGCACGTGCCTCTGAGAAGGGTATGCTGTA TCGCAATAATAATATGCACGCTCATGCGCGTGTGGCGTCCATTCAGCAAGCGCAGCACCCACCGTNAGGAAAAATTTTTC TTATGCTTTTGGTGCCAGATCAAATATCTCTTTCTGCGGCTCTTGTGGGCGTCACACTTGTTGTTGTTTTCATGTATTTC CGTCAACAACCGTTTAGCTTCAACACAAATAAACAGAGCTGGATTTCAGGTGCTCTTAATGAGCATGAATTTCATCAACG CAATAGGGAGATGAGTTTAGTCCTTGAGGCTCACAAGAGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1841501: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415013421544AI083121TENU3798T. cruzi epimastigote normalized cDNA Library


Date: 1:37:25 on Sat 18 Nov 117.