EST 1841517 is a singleton


Sequence

>1841517 (1 EST) Length=497 GGTGGTCCCCGTAGTGGCGACGGTGTCTGTGGTGGTGCCGATGATGGCAGTCTCGCGGGAGGTGGAGCTGCGGAAGAAAA CGCCTCATCATGTGATGCCTTCCGTGAAGGAAACCATCTTGGCCGGCCTCAGTGACGCGCCCGCGTCGAAGCCCACACCA ACGCCACCACCACCAGCACCACCAGCACCAGCAGCGGCGGCGGCACACCGCCCGTGACTACTCCGACTCCTACGACGATC CCTACGACTAATAGCGCCAATGCCGACGTCATTACGTCCGTTGTTACGCCCTCCCCTACACCATTAGCGGCAAGAACTTC GACAACTCCCATCGCTGTGCCTCGTGTGGGGAGGGAAGGGGAGGGGAGGGAAGAGGGCGTAAAAGGCCCAATTTGCGTGT TGTCACGTGACCCGAAGTTTGATGGGGGGAGTGAAAACTCCCATCAGGAATTTTCTTCTATTCCCTTTTCTCTCTCTTTT TGTATGGGGGGATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1841517: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415173421560AI083137TENU3814T. cruzi epimastigote normalized cDNA Library


Date: 6:3:19 on Wed 22 Nov 117.