EST 1841518 is a singleton


Sequence

>1841518 (1 EST) Length=524 TGTGACATTGAATTCCAACAATAGGGGATTGTCTCTCATGCGCAACGTGGATGAGTGGGGGACCTCCATGGCTGTTCAAT TAGCTGGGGTAATATCGCCTCTCATCAGCATTTGGCCTGAGGCTTATCGAGCCAAATTTGTTTACGGTGCCGCTTTTTTA TCAAGATGGTTTCCAAGCATTGATGCTCTCAAAGATGTCTCGGAGTATATTGATGGCTTGATTGCTGATGGGAAAAAAGA TCGTATTTTACTTATCGGTGATCAGTTTAACGGGGGATACGCCAAAATTCTTTCCTCCAGATTGGGTTTGCCCTTTGTTG CATTTAACCCCCCCGGGGCTAAATACAAATTGCCTTCAGTAGTCGAGGGAGTGCAGATTTTTTTTACCCATGGGATTCTT TCCTACGTTGATTCTCTTGAAGACACCTTGACCACCTTGTGTCTGGAGTGTGACGCTGATTATTCTTCTATCCGCTGCAG TAGAATTGAGACCACTATTGAGGTGATTAGCAACCTGTGTGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1841518: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415183421561AI083138TENU3815T. cruzi epimastigote normalized cDNA Library


Date: 23:49:28 on Fri 17 Nov 117.