EST 1841520 is a singleton


Sequence

>1841520 (1 EST) Length=469 GTTGGAGGTGGCCAAAGCGACGGTACGACGCCTTTCCCTGCAAGATGTTGTGAAGGTGGAGGAGGGGGAGGAAGAGAGGG GCACGACGCCTGGTCCGACCTCGCCTATGGATTGCCAAGAGAGCACCGAATCAAATACATGAAGAGACGGATTCAATTTT GGAGGGACCTTGTTTTTGTTGTTGTTGTTGTTGGCATTGTCGTCTTTTGTATGGCAATAGTGGAGCAGTAGAATTTTATA TATAAAGACAATTTTGTGTCTGTCTGTGTGTTCGTGTGTGTGTGTTACCGTTTTTTCCCCCTGCTTGTTTGTTGGGCGTG TCTCGGGGGGGAGGGGGAGAAAATAATTGTTGATTTCACTGCCTCCTCTCTCTCTCTCTTTTGTTTGTTTGTTTGTGTGT TTTTTTAATATCGTCCGTCGTTGTGTCTTTTGTTAACGTTCTGTCAGTTTGTTTGAGCCTACACTCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1841520: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415203421563AI083140TENU3817T. cruzi epimastigote normalized cDNA Library


Date: 17:50:35 on Mon 20 Nov 117.