EST 1841522 is a singleton


Sequence

>1841522 (1 EST) Length=430 AGGCCAGAGTCTGCAGTCTAATGAAATTTCCGATCTGCGTAAGATTCTTCACTATCCTCCACAGCAGTCTCCGCCTCCTT CTGCTATGCTGTGCCATTTGTCAGAAACGAACATTGATCTTGAGAAGGAAGCTAAGCGTCGTCGACAGACAGGTGGCGAT GATGACGACGATGCACCACAAGGGCACACTGGCGCGACTTGTACGCAACAGTAGTCCCTTTAAAGAAGGAGGAAATAAGA AAAAGAAGGAGGAAGAAATAGAAGAGGAAGCAAGAAAAAATTATTATTCTAGAAAAACTATAAAATCATGCTTGTTACTT TTTTTTTCTCATCCTCTCCCCCCCTGCTAAGGTTCTAATAGCTAAGCAATTGTTGAAATATTTGCCTCTTTTTCCGAAGC CGCCTGCATGGGGAGAGATAAGCGAGCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1841522: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415223421565AI083142TENU3819T. cruzi epimastigote normalized cDNA Library


Date: 4:1:59 on Thu 23 Nov 117.