EST 1841537 is a singleton


Sequence

>1841537 (1 EST) Length=429 GTGCCTGTTGTACGAAAACTACATTGTGAACAAGCTACCAACGGAGCGTATTCGCGAGATTATTTGCAGTGCGGTGGACA TTGAGCGTGAGTTCATCTGTGACTCCATCCCTGTGCGGCTGCTGGGGATGAACGCAGATTTGATGTCGACGTACATCGAG TTTGTGGCGGATCGGCTGCTGGTGGCACTTGGCAACGAGCGTCACTACAACTCAAAGAACCCATTCGACTTTATGGAAAT GATTTCACTGCAGGGAAAGACAAACTTCTTTGAGAAGAAGGTCGGTGAGTACCAAAAGGCGGGTGTAATGAGTTCGGAGG GGACTACAAAGGTTTTCTCTCTCGACGCGGAATTTTAGTGGCAAGAGCCACACAGTAATACATAATAGCAAACATACAAG AAGCTAATAGAGTAAAATGGTATATTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1841537: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415373421580AI083157TENU3834T. cruzi epimastigote normalized cDNA Library


Date: 6:55:34 on Mon 20 Nov 117.