EST 1841546 is a singleton


Sequence

>1841546 (1 EST) Length=264 GAGGAGGAGGGAGAAGTGACTGCTCACTGCCGAGTTCAATCAAACCGCCACCACCACCACCACCGCCGTTAACGTCGTGG AAGCACAAAAACACAAAAACACACACACACAAAAGAACAGCAACAAAAAATGGAAGGCCCGAGTGCTCCTCAGCAATAAC CTTCAAAATTCACCTCGTGCACCGCGACGGACATCGCCTGTTTGCATTTGGAGGAATGTCCGCTGCCAGGAAGAGAAATT GTCAATTTTGAGCGAGAAGAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1841546: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415463421589AI083166TENU3844T. cruzi epimastigote normalized cDNA Library


Date: 6:31:9 on Thu 23 Nov 117.