EST 1841552 is a singleton


Sequence

>1841552 (1 EST) Length=370 TTGCCGTGCGTTGGCATGTCGCCAGGCGATGTGTTTACCGCTAAGGCCCCCTTCGTGTTGGTGGAGCAGTTCTGCGAAGG AAGGCCGTATGATACGATGACATTTCCTGATGCCTTTGAGATTGCACCGAACAGTTGGCAGTACAGGCCTGCAGTGGCCG CCGTGCCGGAAGTGATCATGTCACCATCGCCAGATGCTGCACATTCTGCTCACAAGAAAAATAAGCGTTATTTATTGCCT TTGGGCGAACGAGCCGCCCGACGGTGCACGGTGGGATGCACGAGGAGCAGCGGATGCAGCTGCAGCGTCGTGCACAGGAA CGAAGAGATCTGCAGCTGATGGCTGGACAAGCAACGTACGAAGCGTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1841552: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415523421595AI083172TENU3850T. cruzi epimastigote normalized cDNA Library


Date: 0:22:35 on Sat 25 Nov 117.