EST 1841564 is a singleton


Sequence

>1841564 (1 EST) Length=273 GTGGATGATATGGCGGAAAAACACATCTCGTCATGCCTCAGTGGCTGCCGCCATGTTTTGGCGTTTGTCTCAGAGGAGCG ACCGACGCTCACGTCGACACCGCATTTGGGGCGGGGCATGTATACGGGTCTCTTATGACCCGCTGGATGGCAGCAGCATC ATCGCGACGAATTTTTCTGTCGGTTCGATCTTTGCTCTCTGGCCTGGTGCCACGCCGATTGGGCTGCGCGTGCGTGATAT GGTGGCGAGTGTTGTGGCGGTATACGGCCCGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1841564: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415643421607AI083184TENU3862T. cruzi epimastigote normalized cDNA Library


Date: 8:12:50 on Wed 22 Nov 117.