EST 1841572 is a singleton


Sequence

>1841572 (1 EST) Length=490 AATCCCAACAGTGACCCCGGGGATGTTGTACGGATGCTGCTGGAGGCTGGCGCGGATGCGAATTGTGCGACGATGCGCAA TGTACGGCGTTGTACTATGCCATCTGCAACGGCTACGTGGATGCCGCCCGCGTGCTGCTGGAGCACTTGCCGCAACTTTG CACATCTCGTTCGTCTGTGCCGTTACTCGTTGCTCTTGGGGCGCATCATTTTCACGCGCGCGAGAGTGACATCCGTCGTC TCTGCGATTACATTCCATCGGTTGACATGCTACGAGTACTTCTGCCGTACCAAACAAGTCTGCCTCTTCTGCGTCTTTGC GTTGAGATCATCAGGGGCAAACTCCGCGGCGAGGAGCGTTTGCGGCACCAACCGATGACACTTCCATTTGGTGCCCCGAC GGTGAGTTGGAGCTTCGGACGCCAGAAGAAGAAAAGTTCCTCTTGGACATCATTGCGCACAACAGCAGGCTTTGCAGCAG TTTCGCGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1841572: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415723421615AI083192TENU3870T. cruzi epimastigote normalized cDNA Library


Date: 2:14:49 on Wed 22 Nov 117.