EST 1841575 is a singleton


Sequence

>1841575 (1 EST) Length=442 CCCCTCATCACGACAAGGAACTCCGTTCAATCTTCTTTTCAGCCGAATGATTCTTCGGCCGCCGTCACAAATCCGGAAGA GACTATTCCGCAGCTGATCCCGTCCGAATTACTGCAGACATCTGTAGCGAGCGATGCAAATAGGCACAAACAATTTGAAC AAACACCGTTGCCGAGGAAGGAAAAGAATGGGAAATGTGTAAAGTGTTGTGCAACCATGTAAGTTGAGGCTCTAGTGTTG TTGTTTATTTATTTATATCTCCCCCTGTTTTCTTGTGTTTCCTTGCGGTGCCTTTCATTATTATTTCTTTCTGTTTGTGT CTCTGTGTATGTGCCATAGTTTGCTTAACCTTGTTGCGTTTGTGTGTTCACACCAACGAAAAAAGAAAGAAAGAGAAAAT AAAAACAATTTATTGTTCGTGTTGTGGCGCATATCGTGTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1841575: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415753421618AI083195TENU3873T. cruzi epimastigote normalized cDNA Library


Date: 9:39:53 on Thu 23 Nov 117.