EST 1841582 is a singleton


Sequence

>1841582 (1 EST) Length=549 GTCCAGTAAATATTCCCATAGAGCAGTTTTTATCTGTTATTGAGAAACGTGGGGATGAGATTGCGGTTATTTTGATGAGT GCCGTTCACTTTTTAACCGGACAATTTTATGACCTTCAAACCATCACAAAGGCGGCCCATGAAAAGGGTATTTTTGTCGG TGTAGACTGTTCCCACGCTGTGGGGAATGTCCCACTGAAATTGCATGACTGGGAAGTGGATTTTGCATGTTGGTGTAATT ACAGATATCTTAACAGTGGCCCCAGTAACCTTGGTGGTGCGTTTGTGCACAGCAAGCACACTTCGGTGGAAAATGAGTTG AAGCCGTTACGTGGTTCGTGGGGCCATGATCGCCGGAACCGCGCTAGTCTACATCATAACTTTGAGCCCGCAGAAGGAGC GGCGAGTTTTCAAATTAGCAACGTCTCTGCTGTCGGCATGATGGCGATGCTGCCAAGCATCCGTCTCATGGCTGAGGTTG GGATGGGGCCACTACGTGAGAAGTCCATGTTGTTGACATCTTACATGGAGCTGTTGTTGAGTGAGTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1841582: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415823421625AI083202TENU3880T. cruzi epimastigote normalized cDNA Library


Date: 21:26:21 on Fri 24 Nov 117.