EST 1841596 is a singleton


Sequence

>1841596 (1 EST) Length=401 ATGGAGATCCTCCTCTCCCTCGTCATGGCACGTAACAAGACGACGGTCAACGAGGATGTCCGCAACTACAGGATCCTGCA CGAGGCGGTGAATAGAGAAAAGACCGCTTCCGCAGATGTCAAGGCCCTGAAGCGGGAGTACCAAGAAACAAAGGAATCAC ACAAGAAGGAAGTGGAGGCCCTCGAAACGGAGATACAACGACTAGAGGAAGAAATTGATTATACACGTAGCGTTGTCGCA ATGGAATTATCGGCGTTTCTTGAAGTAAATCAACAACTGCAGGGAGAGCGCCAGATGCAAGATGTGGGTCACCTGGAGGA GGTGAAGCAGCTCGCCGAAAAGAATAAAGAAACGCTGGCAACATTGGTGAACCGGAATCAGGAGGAAGCAAACGCATTAA G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1841596: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415963421639AI083216TENU3894T. cruzi epimastigote normalized cDNA Library


Date: 16:29:9 on Mon 20 Nov 117.