EST 1841597 is a singleton


Sequence

>1841597 (1 EST) Length=459 AGGGAAAGCGCGAGACCATCTACCGAGAGGAGAATGCCGCCTCGGTTTGCGAAAAACAACACCACGCCTTTTAAGAAACG GGTCGCCAACCTGTTTCAGATGTACAAGCGGGATTTGTTCTTTTCGTGTGTGGCCCTCGTGGCACTTGGGGTTGTCTTCC GCAGGGAATTGATGCTCCACGGCGTGATTGGTGCCCCGAAGCGGACGGAGGTGCTGCCCAAAGTTGAGAGAGAATTTGGG AAGGGACGGCGTCAGAGAAGCAACGCCAACGACACATGACGCGGGAGGAGCGGAAAGCGGCGATCGAAGCAATAAAAAGG AAAAAGTAAAGGCCTGGGGAATATGTGCACTTATGTATGCGTGTTCATTTCTCCTCGGTGGATGCCCACATGATGTGTCG CGGGATGCAGTTTGATACTTTTCTTCTATACACGCTGAATCCTGAAAACATGCGTTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1841597: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18415973421640AI083217TENU3895T. cruzi epimastigote normalized cDNA Library


Date: 19:20:45 on Thu 23 Nov 117.