EST 1841606 is a singleton


Sequence

>1841606 (1 EST) Length=386 CATAGGAAGGAAATGTGCAATCGTTCCGGAGCAGGCAACGTCTGTATTATGTGGGAGTTCGCTCGTTTTCCTCATCTGCA TTTGTACTGTAGAAGCCTGCAAGACTCCTGGTGCGAAATCTTTCAAGGACCGTCTATTCTACAACATGATGAAATCATCC CGTATTAGTCCTAACAAACAACTGAGCGACACAAGCACTGTCAGTGCGAACGTATCGAGAACCTGAACACTGCTGCCCTA TTCTCTCTTTCCTTCCTTCTTTCCCTTGCTCTGTCTTGCTCTCTCTGTTTCTTCCTTTGAAAGAACCAAACGGGAACTCT CTGGATGCACTTTCCGGTTACTTATTTCTCCGGGTGCCACTCCTNATCTTTTCCCGAAGAGGTGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1841606: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18416063421649AI083226TENU3904T. cruzi epimastigote normalized cDNA Library


Date: 0:58:49 on Tue 21 Nov 117.