EST 1868734 is a singleton


Sequence

>1868734 (1 EST) Length=409 GTTACAGAAGCAATTGCATACTGTGAGGAACGGCTTTTACCCGCCGTGGAACGAATTGACGACAAGCGACAGAAGAAAGT TTTGGAAATGTTGTATGATCTTTTGGTAGAACTACACGCCACACGACTGCTACAAATCTTTCGAGATGGACAAACCGCCG ACCATGTTGTGTTTCAATATATTGCAACTCACCTTCTGCCACACGCGACACGAAGACCAGCTTTTGTGCAGGCTATTATC AACGCTGTAACACCGCAGAATGTGTCTTATAACTCTTCAGCAATAACCGCAGAGAAATCTTTTACGAGTGGAGGCGACGA GCGTTGTTCGGCGTCGCCAAAAGCAAGAAGTGTTCTCACAAAGAAGAACGAAGAGTCAGTGCGCCTTGTGGTTTGCATGA TGTCAGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1868734: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687343482741AI110321TENU3291T. cruzi epimastigote normalized cDNA Library


Date: 6:9:40 on Wed 22 Nov 117.