EST 1868748 is a singleton


Sequence

>1868748 (1 EST) Length=480 GCACGTAATGCTGCTGCTGCTGCTGCTGCTGCTGCTGTTGATGATGATGCAGCAGCAGCAGCGGCTCCCAGCGGTACCGC GCCTGGGCAACTATTGCCAGAGGATCACTTCACACTGAATGTCGATTACACGCACAAGTTGCGCAAGTTTGGGCTTCCGG TGGCTCGTCCCTCTCGCGGCGAGGGGTTCAAAGGGTCGGTTGTTAGCTCCACGCATGTAGAAAAGACAAAAGCGGCTCTC TCGGATGAAATTGAGGCATCCCGACGCATTCAGATGGATGCTGCCATTGTACGTATCATGAAAAGCCGCCGTTCCCTGCG GTACTATGAGCTTTTGACTTGACGGTACAACAGCTTTCAAAACAGTTTGTCCCCCATCCACGCTCTGTGAAGATGCAAGT GGAGGATCTTGTCTGCCGTGGCTTCCTACGGCGACGAGAAAGACACCTCTGTGTTTGAGTACATGGCGTGAGTGTTGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1868748: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687483482755AI110335TENU3305T. cruzi epimastigote normalized cDNA Library


Date: 12:41:41 on Sat 18 Nov 117.