EST 1868749 is a singleton


Sequence

>1868749 (1 EST) Length=207 GAGGAGAAATACCTTTGGAAAGATCCGGACGACATCCTTTATGCAAGTCGAAGGAGTATTATATTACGCGGCATGGATCG TCTGACAAATGCGACATATGCACTGAAATTAATTCCCAAGTTTCGAATGCTTTCACGACGATTATGTCAAAGGCTACAAC AAGGCATTGAAATTCGCATTGCGGCGTCGGCATTTCCAGCGTCGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1868749: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687493482756AI110336TENU3306T. cruzi epimastigote normalized cDNA Library


Date: 2:41:17 on Fri 24 Nov 117.