EST 1868751 is a singleton


Sequence

>1868751 (1 EST) Length=255 TTTTAGGCATTTTCTACCCTTTTTTTTTTCTTTTAAAAAGAATTTGATGCTTTATTTTATTTTATTTTATTTATTTATTT ATTTTGTCTTTAGGATTTTGTATTTTGTTTTAAATGGATGTGTGTTTTCTTAATACGTAGCTGAGTGATTTTGCCCCCCA TTAACAACAGACCAATTTTATTATTATTATTATTGATTTTGTACTTACGGCTGTCTTGGACTTTAAGATGTGGTTGCGGG GAGTAATGGGCGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1868751: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687513482758AI110338TENU3308T. cruzi epimastigote normalized cDNA Library


Date: 2:43:50 on Thu 23 Nov 117.